Updated 11/05
1. Take up cells in 1-5mL lysis buffer OR dounce tissues in 10-25mL lysis buffer.
2. Spin low speed, 1500xg (3500-4000 RPM on GSA, 1000 RPM in a clincal centrifuge), 5Õ, 4¡C. Remove supe by hand (keep if you want the cytosolic fraction).
3. Resuspend gently in low salt buffer about 1-10mL. Shake tube by hand to resuspend pellet. Spin 1500xg (1000RPM clinical centrifuge, 3800 RPM eppendorf minicentrifuge), 5Õ, 4¡C. Remove supe by hand and get all supe off.
4. Resuspend nuclear pellet in an equal volume of high salt buffer (about 0.1-1.0 mL). Vortex hard. Let sit on ice for 30-60Õ vortexing occasionally.
5. Spin in tabletop ultra, 0.5mL per tube (14 tubes max) at 50,000RPM, 30-60Õ, 4¡C in TLA 120.1.
6. Take off the clear supe leaving behind the thick pellet. Store at –80.
7. Protein assay with Pierce DTT compatible kit. I get about 1ug/uL from tissue, to 100ng/uL for cell culture.
8. Lysis buffer (for 50mL)is:
0.5mL Hepes 1M pH7.9 10mM
0.17 mL 1M KCl 10mM
0.1mL 1M MgCl2 2mM
2.5 mL 10% NP40 0.5%
150uL 1M DTT 3mM
46.6 mL ddH2)
Also to all solutions just before using add protease inhibitors (i.e.: PMSF, aprotinin, etc) and phosphatase inhibitors (i.e.: sodium fluoride 1mM, sodium orthovanadate, beta-glycerolphosphate 1mM)
9. Low salt solution (for 10mL) is:
200uL Hepes 1M pH7.9 20mM
3.1mL 80% glycerol 25%
20uL 1M MgCl2 2mM
0.33 mL 3M KCl 0.1M
20uL 0.5M EDTA 1mM
50uL DTT 1M 5mM
6.45 mL ddH2O
10. High salt solution (for 10mL) is:
200 uL Hepes 1M pH7.9 20mM
3.1mL 80% glycerol 25%
20uL 1M MgCl2 2mM
3.3 mL 3M KCl 1M
20uL 0.5M EDTA 1mM
50uL 1M DTT 5mM
3.35 mL ddH2O
----------------------------------------------------------------------------------------------
Note: For MEF2 from Cb granule cells, C. Cowan uses a cell lysate instead.
50mL cell lysis buffer
20mM Tris-HCl (pH7.8) 1mL 1M
100mM NaCl 1mL 5M
1mM EDTA 100uL 0.5M
0.5% NP-40 2.5mL 10%
with protease and phosphatase inhibitors
for –KCl adds 5mM EGTA
for +KCl adds 2mM CaCl2
about 500uL per plate (12 well, 100mM)
spin to clear
check protein concentration by Bradford.
------------------------------------------------------------------------------------------------
1. Use 2 complementary primers. These can have overhanging ends then fill in with dCTP or blunt ends that you end label with gamma ATP.
2. Use 6.7uL each primer (at 30pmol/uL)
3. Add 4uL NEB buffer 3 and 22.6 uL ddH2O
4. Boil 10Õ in a heat block or water bath. Turn the heat block off or remove the bath from heat and slowly cool to room temp (about 90Õ).
5. This solution is 5pmol/uL. You need 2.5pmol per probe, so only 0.5mL of this solution. The rest can be stored at –20 until next use. If annealed probes go through multiple freeze-thaws, best to reanneal.
1. Mix 2.5uL 32P-gamma ATP (6000mCi/mL)
0.5uL annealed oligos
2uL T4 polynucleotide kinase buffer
1uL T4 polynucleotide kinase
14uL ddH2O
2. 37 degrees for 45Õ
3. Add 80uL TE to stop.
1. Mix:
0.5uL annealed probe
2uL of dATP, dGTP, dTTP each pre-diluted to 1.25mM
1uL EcoPol buffer
2.5uL 32P dCTP
1uL Klenow.
2. RT for 1hour.
3. Add 90uL TE to kill.
1. Make Sephadex G25 (pharmacia superfine DNA grade) in TE.
2. Load 1mL on BioRad chrom column.
[NOTE – GE/Amersham now sells G25 columns prepacked.]
3. Put column in a 2mL tube.
4. Spin 2Õ at 2000RPM to get TE off.
5. Add probe, spin 2Õ at 2000RPM to collect probe into tube.
6. Count 1uL probe (expect about 10000 CPM)
7. Can store at –20 for up to 2 weeks (one half-life)
8. For use, dilute at least 1:10 (=2.5fmol/uL).
1. Mix:
3uL 4X binding buffer with DTT
1uL dIdC (stock = 1ug/uL)
2uL ddH2O (or antibody for supershift)
2uL ddH2O (or mutant or wt cold probe 0.25pmol/uL for competition)
2uL hot probe (25fmol/uL)
2uL protein (NE or TNT)
For supershift, mix protein and antibody, sit at RT for 30Õ
Add DNA probes and sit at RT for 20Õ
During this time pour the gels.
2. The stock 4X binding buffer for CaRF is:
80mM Hepes pH 7.9 800uL 1M Hepes 7.9
0.8mM EDTA 16uL EDTA 0.5M
40% glycerol 5mL 80%
16mM MgCl2 160uL 1M
3.6mL ddH2O
store at –20.
Just before use add 10mM DTT
144uL 4X binding buffer stock
6uL 1M DTT
------------------------------------------------------------------------------------
For MEF2, Chris Cowan uses a different mix:
4X MRE gel shift buffer
80mM Tris pH 8
400mM NaCl
4mM EDTA
2% NP40
Make mix as described above, but BEFORE LOADING ADD 6uL 25% GLYCEROL TO EACH SAMPLE!!!!
--------------------------------------------------------------------------------------
3. dIdC is made up in TE with 0.1M NaCl, store at –20.
1. acrylamide gel is:
1mL 25% glycerol
1mL 10X RB
2mL 30% acrylamide (final = 6%)
6mL ddH2O
25uL APS
10uL TEMED
alternative: use 0.5X RB for the gel and the buffer and add 1mM Mg(OAc)2 to both solutions. Then run gel at 85V at 4 degrees for about an hour. This may improve CaRF signal.
2. 10 X Running buffer is:
25mM Tris-borate pH 7.5
48.4g Tris base per liter
pH with LOTS of boric acid until pH 7.5
3. Load samples carefully without dye – keep track of lane #. Run DNA sample buffer in another lane so you can watch the progress of the run.
4. Run 150-200V for about 20-30Õ until the bromphenol blue dye is just above the bottom of the gel. This will keep the probe on the gel.
5. place gel on Whatman and dry for 30Õ. Expose 1hour – O/N on Phosphorimager cassette.
100mL 1M Hepes
pH 7.9
23.8g Hepes
70mL ddH2O
pH to 7.9 with about 5.5mL 10M NaOH
make to 100mL with ddH2O
recheck pH
autoclave and store at 4.
PRIMERS:
CaRE1 (BDNF) sense: gagtgtctatttcgaggcagaggagg
CaRE1 (BDNF) antisense: cctcctctgcctcgaaatagacactc
CaRE1 (BDNF) mutant sense: cctcctctgcctGgCGGAagacactc
CaRE1 (BDNF) mutant antisense: gagtgtctTCCGcCaggcagaggagg
CaRE1 (consensus) sense: gagtgtYCaRAAcgaggcagaggagg
CaRE1 (consensus) antisense: cctcctctgcctcgTTYaGRacactc
MRE (MHC) sense : ctctaaaaataaccct
MRE (MHC) antisense: agggttatttttagag
MRE (brain) sense: agtgttactataaatagatacaat
MRE (brain) antisense: attgtatctatttatagtaacact
CRE (BDNF) sense: gttgacagctcacgtcaaggcagc
CRE (BDNF) antisense: ctgctgccttgacgtgagctgtc
CRE mutant sense: gttgacagcCAGcTGcaaggcagc
CRE mutant antisense: ctgctgccttgCAgCTGgctgtc
CaRE2 (BDNF) sense: gtgagctgtcatatgatacctcctctgcctc
CaRE2 (BDNF) antisense: gcggcagaggagg